site stats

Himadri pakrasi lab

WebPlasmid pSL3005 from Dr. Himadri Pakrasi's lab is published in Sci Rep. 2024 Jan 15;10(1):390. doi: 10.1038/s41598-019-57319-5. This plasmid is available through Addgene. Web21 dic 2024 · This study provides direct evidence of the involvement of these proteins in supporting nitrogenase activity in Anabaena 33047, a heterocystous cyanobacterium that has an affinity for high light intensities. This strain was previously known to be recalcitrant to genetic manipulation and, hence, despite its many appealing traits, remained largely ...

Rajib Saha College of Engineering - University of Nebraska–Lincoln

Web23 giu 2016 · We thank all members of the Pakrasi lab for collegial discussions. Competing interests. The authors declare that they have no competing interests. ... Kristen E. Wendt, Justin Ungerer & Himadri B. Pakrasi. Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign, Urbana, IL, 61801, USA. Ryan E ... WebHimadri Pakrasi's current focus is on bioenergy production in cyanobacteria. His lab studies how cyanobacteria use solar energy to drive the chemistry of life. They work in … bam ranking 2021 https://csgcorp.net

Exploring native genetic elements as plug-in tools for synthetic ...

Web12 ott 2011 · Himadri Pakrasi, PhD, the George William and Irene Koechig Freiberg Professor of Biology in Arts & Sciences and Cynthia Koehler, research technician, check on algal cultures in his lab. Pakrasi’s group has just won a $2.2 million Department of Energy grant to determine how cyanobacteria (blue-green algae) might be modified to produce fuel. WebHimadri PAKRASI Cited by 13,261 of Washington University in St. Louis, Missouri (WUSTL , Wash U) Read 386 publications Contact Himadri PAKRASI WebAs we were planning in our respective projects to use the same sucrose secreting cyanobacteria strains, we gave them our contact in the Pakrasi lab so that they could also recover them. Throughout the project, we exchanged data, protocols as well as tips regarding how to grow our cyanobacteria as efficiently as possible. arsenal 2009

An inquiry into protein structure and genetic disease ... - PubMed

Category:Addgene: pCB-SC101-Spe

Tags:Himadri pakrasi lab

Himadri pakrasi lab

Himadri Pakrasi Department of Biology

WebLoop is the open research network that increases the discoverability and impact of researchers and their work. Loop enables you to stay up-to-date with the latest … WebPlasmid CRISPR-psbA2 point mutation from Dr. Himadri Pakrasi's lab contains the inserts ddcpf1, gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc, and psbA …

Himadri pakrasi lab

Did you know?

WebLABORATORY TECHNICIAN. 314-935-6862. [email protected]. I am a technician in the lab and enjoy working here with a group of energetic and passionate people! I am responsible for maintaining cyanobacterial … WebHimadri Pakrasi, Michelle Liberton, Jana Stockel, and Eric Welsh. ... Dr. Louis A. Sherman's Lab Hansen Life Sciences Research Building Rooms 131-135 Telephone: 765-494-0560 Fax: 765-496-1496. DEPARTMENT OF BIOLOGICAL SCIENCES Purdue University, West Lafayette, IN 47907

WebPlasmid pCB-SC101-Spe from Dr. Himadri Pakrasi's lab is published in Microb Cell Fact. 2024 Mar 26;17(1):48. doi: 10.1186/s12934-018-0897-8. This plasmid is available … WebHimadri Pakrasi Lab Materials. The Himadri Pakrasi Lab has deposited materials at Addgene for distribution to the research community. Addgene is a nonprofit plasmid …

WebHe has been on the faculty of Washington University in St. Louis since 1987. Pakrasi is a biochemist recognized for his work on photosynthesis and bioenergy production. He has … Web14 dic 2010 · The single-celled cyanobacterium Cyanothece 51142 can make hydrogen in air, Himadri Pakrasi of Washington University in St Louis, ... Himadri Pakrasi's lab. …

Web开馆时间:周一至周日7:00-22:30 周五 7:00-12:00; 我的图书馆

WebThe Pakrasi Lab studies how cyanobacteria use solar energy to drive the chemistry of life. We work in multiple disciplines and at many scales, studying how the molecular … bam railroad siberiaWebPlasmid pRha-rsw-EYFP from Dr. Himadri Pakrasi's lab contains the insert EYFP and is published in ACS Synth Biol. 2024 Jun 19;9(6):1441-1449. doi: 10.1021/acssynbio.0c00106. Epub 2024 May 21. This plasmid is available through Addgene. bam rankingsWebPlasmid pSL3005 from Dr. Himadri Pakrasi's lab is published in Sci Rep. 2024 Jan 15;10(1):390. doi: 10.1038/s41598-019-57319-5. This plasmid is available through … arsenal 201arsenal 2010/11WebPlant and Microbial Biology student in the lab of Dr. Himadri Pakrasi. Studying molecular mechanisms of high light tolerance in a fast growing cyanobacteria. arsenal 2008/2009WebHimadri Pakrasi George William and Irene Koechig Freiberg Professor Department of Biology McDonnell 045 Washington University in St. Louis Campus Box 1137 One Brookings Drive St. Louis, MO 63130, USA. [email protected] Phone: (314) 935-6853 arsenal 2005-06 wikiWebPakrasi conducts research in the broad areas of photosynthesis, systems biology and synthetic biology. He is deeply engaged in bridging research interests in physical and … arsenal 2009 2010